SitemapImpressumDatenschutzerklärungdeutschenglish
MHH Logo

Forschungsbericht 2001

 

 

"Proteomics" von Porphyromonas gingivalis im Überstand von gingivalen Epithelzellen

S. Dogan¹, W. Geurtsen¹, WO. Chung², Y. Park², W. Chen², M. Hackett², RJ. Lamont²
¹ Medizinische Hochschule Hannover
² University of Washington, Seattle, USA

Der Hauptfaktor in der Ätiologie und Progredienz einer Parodontalerkrankung ist die Ansammlung von Mikroorganismen im Bereich des Zahnhalses und der marginalen Gingiva. Ein wichtiges Bakterium für die Entstehung einer Parodontitis ist Porphyromonas gingivalis. Es handelt sich um einen pleomorphen, meist stäbchenförmigen, gram-negativen, nicht-sporenbildenden und nicht-motilen Keim. P. gingivalis kann in gingivale Epithelzellen eindringen, wobei deren Genexpressionen in Abhängigkeit von der Umgebung wechselseitig moduliert werden. Wenn der Keim mit den Epithelzellen in Kontakt kommt, scheidet P. gingivalis in seine Umgebung Proteine aus, welche für die Virulenz dieses Keims eine wichtige Rolle spielen können. Um die Rolle dieses Bakteriums für die Ätiologie der Parodontitis zu erfassen, ist es sehr wichtig seine Proteine zu identifizieren. Da Modifikationen der Proteine auf der DNA-Ebene nicht zu erfassen sind, dienen proteomische Methoden zur Identifizierung der post-translationalen Modifikationen der Proteine. Mit Hilfe dieser Techniken kann die Korrelation zwischen Protein- und mRNA-Expression untersucht werden.

Das Ziel dieser Studie ist es, die `regulierten´ Proteine von P. gingivalis im Überstand von gingivalen Epithelzellen zu erfassen und die Korrelation zwischen Protein- und mRNA-Expressionen zu bestimmen.

Bislang wurden folgende Oligonucleotide (Primer) für die nicht identifizierten Proteine entworfen:

 

Primer Paar

Sequenz (5’ bis 3’)

17 kDa-F

17 kDa-R

ATGATTCGATGCAGCATTTG

CGGATTCATCGCCTCTCTAA

22 kDa-F

22 kDa-R

ATGCTCAGAGTCGTCCTGCT

TATCCGGAGCATCCTTCAAC

29 kDa-F

29 kDa-R

CTCTTCTCCCTCACGGAACA

GTTCGGTAGGTCTGCCATGT

36 kDa-F

36 kDa-R

TGTAGCCATCAACGACCTGA

AGCCATGTAGGCGATGAGAT

61 kDa-F

61 kDa-R

GGGAGGAGATGATGTCAAGG

CATACCGAATGTCCCAATCC

152 kDa-F

152 kDa-R

GCTCATTCAACGACAAGCAA

TAGGGGTTAGTGTCGCCAAG

HmuY-F

HmuY-R

TCTGTGCATTGCCATTGATT

TTACCATCAGCACCACGAAC

 

F: Forward, R: Reverse

Ferner wurden Oligonucleotide (Primer) aus der Literatur übernommen:

 

Primer

Referenz

kgp

Xie H et al. Infect Immun 2000;68:6574-9

rgp

Major Fimbrillin

Minor Fimbrillin

Chung WO et al. Infect Immun 2000;68:6758-62

 

Unsere bisherigen Ergebnisse zeigen, dass die Lysin-Protease (Kgp) und die nicht identifizierten Proteine 22 kDa und 36 kDa auf der Protein- und mRNA-Ebene nicht reguliert werden (Abb. 1). Obwohl HmuY und die nicht identifizierten Proteine 17 kDa und 61 kDa auf der Proteinebene nicht reguliert waren, waren sie auf der mRNA-Ebene unterreguliert (Abb. 2). Außerdem waren die Expressionen von Arginin Protease (Rgp), Major Fimbrillin (FimA), Minor Fimbrillin (Minor Fim) und den nicht identifizierten Proteinen 29 kDa und 152 kDa in der Umgebung von Epithelzellen unterreguliert (Abb. 3). Eine Korrelation zwischen den Protein- und mRNA-Expressionen wurde für Arginin-Protease, Major Fimbrillin und Minor Fimbrillin gefunden. Es gab keine Korrelation für 152 kDa- und 29 kDa-Protein auf den beiden Ebenen. Somit konnte bislang nachgewiesen werden, dass P. gingivalis die proteolytischen und fimbrialen Proteine im Kontakt mit Epithelzellen regulieren kann. Dies gilt auch für die Genexpression auf der post-transkriptionalen Ebene.